Genetics Analysis and Principles Robert Brooker 4th Edition -Test Bank

Genetics Analysis and Principles Robert Brooker 4th Edition -Test Bank

Description

Chapter 15 Gene Regulation in Eukaryotes
Student: ___________________________________________________________________________
1. Which of the following would also work as an enhancer for the following bi-directional enhancer?
5 GTTC 3 3 CAAG 5

A. 5 GAAC 3 3 CTTG 5

B. 5 CTTG 3 3 GAAC 5

C. 5 CAAG 3 3 GTTC 5

D. More than one of the answers are correct

2. What structural motifs promote dimerization?

A. Zinc finger

B. Leucine zipper

C. Helix-turn-helix

D. Helix-loop-helix

3. Which of the following is a steroid receptor?

A. GRE

B. IRE

C. CRE

D. None of the answers are correct

4. Which is not an example of RNA processing regulation?

A. RNA concentration

B. RNA editing

C. Alternative splicing

D. eIF2a protein kinases

5. Based on the following mature mRNAs, what exons are constitutive?
I. 1-2-3-4-7-8-10 II. 2-4-5-6-7-9 III. 1-4-6-7-8 IV. 1-2-4-7-10

A. 1 and 2

B. 1 and 4

C. 2 and 7

D. 4 and 7

6. What is an example of RNA editing?

A. Changing a valine codon to a stop codon

B. Methylation of cytosine bases

C. Formation of RISC

D. Alternative splicing

7. Which of the following mRNAs would be found at the lowest concentration?

A. 5 GGAUGGCCGUUUGAAAAAAAAAAAAAAAAAAAAA 3

B. 5 GGAUGGCGACCUGAAUUUAAUUUAAUUUAAAAAA 3

C. 5 GGAUGGAAGUUUGAAUUUAAUUUAAAAAAAAAAA 3

D. 5 GGAUGGGGACUUGAAUUAAAAAAAAAAAAAAAAA 3

8. Where is the IRE located in the ferritin gene?

A. 5 end of DNA

B. 5 end of mRNA

C. 3 end of DNA

D. 3 end of mRNA

9. A mutation in which of the following would result in little or no expression of a gene regulated by a CRE?

A. G protein

B. Adenylyl cyclase

C. Protein kinase A

D. All of the answers are correct

10. What activates CREB?

A. Binding of cAMP

B. Phosphorylation

C. Dimerization

D. None of the answers are correct

11. What would be the result of a mutation in Hsp90?

A. Glucocorticoid receptor could not form a dimmer

B. The nuclear localization signal would no longer function

C. Expression of the regulated genes would become constitutive

D. The hormone would not be able to bind to the glucocorticoid receptor

12. Which mechanisms are used by miRNAs to regulate gene expression?

A. Targeted degradation of mRNAs

B. Targeted inhibition of mRNA translation

C. Both A and B

D. Neither A nor B

13. A person with a mutation in IRP that prevents it from binding iron. What effect will this have?

A. Ferritin will not be made, so iron intake must be maximized

B. There will be excess ferritin, so iron intake must be lowered

C. Transferrin will not be made, so iron intake must be maximized

D. There will be excess transferrin, so iron intake must be lowered

14. What mechanism of RNA regulation is responsible for the two different forms of apolipoprotein B?

A. Alternative splicing

B. RNA editing

C. RNA interference

D. Covalent modification of RNA

15. What basal transcription factor is most often affected by regulatory transcription factors?

A. TFIIB

B. TFIID

C. TFIIE

D. TFIIF

16. SR proteins are splicing factors rich in _____.

A. Arginine

B. Cysteine

C. Asparagine

D. Proline

17. Which of the following relationships is true?

A. The more stable an mRNA is, the higher its concentration

B. The more unstable an mRNA is, the lower its concentration

C. The more unstable an mRNA is, the higher its concentration

D. More than one of the answers are correct

18. eIF2a is phosphorylated in order to inhibit transcription. What is occurring at the molecular level?

A. Phosphorylated eIF2a binds to tRNAs, preventing them from attaching its amino acid

B. Phosphorylated eIF2a binds to eIF2B, inhibiting its activity

C. Phosphorylated eIF2a binds to the mRNA, blocking the Shine-Delgarno sequence and preventing translational initiation

D. All of the answers are correct

19. S1 nuclease will cleave which of the following?

A. Double-stranded DNA

B. Single-stranded DNA

C. A single-stranded probe hybridized to a particular gene

D. Chromosomal DNA in an open conformation

20. In which of the following scenarios would gene expression be the lowest?

A. The CpG island upstream of the gene is unmethylated

B. Injecting antisense RNA corresponding to the mRNA of the gene

C. Deletion of a sequence upstream of the gene known to be a silencer

D. Injecting double-stranded RNA corresponding to the mRNA of the gene

21. Transcription factors recognize which of the following?

A. Response elements

B. Control elements

C. Regulatory elements

D. All of the answers are correct

22. Which of the following is an example of a motif found in transcription factors?

A. Zinc finger

B. Leucine zipper

C. Helix-turn-helix

D. Helix-loop-helix

E. All of the answers are correct

23. Regulatory transcription factors may influence gene expression in which of the following ways?

A. Recruiting proteins to the promoter that enhance chromatin compaction

B. By effecting the ability of TFIID to bind to the core promoter

C. Influencing the ability of the RNA polymerase to form an initiation complex

D. All of the answers are correct

24. Regulatory transcription factors may be regulated by __________.

A. Covalent modifications

B. Protein-protein interactions

C. Use of effector molecules

D. All of the answers are correct

25. Which of the following is incorrect regarding the glucocorticoid hormomes?

A. They interact with receptors located in the plasma membrane of the cell

B. After interacting with the receptor, they release HSP90

C. The receptors form a homodimer that travels to the nucleus

D. The homodimer interacts with GRE, activating transcription

26. cAMP is known as a second messenger system since the pathway is first activated by a extracellular signaling molecule

True False

27. Which one of the following directly interacts with the DNA as a transcriptional regulator?

A. cAMP

B. G protein

C. Protein kinase A

D. CREB protein dimmer

E. None of the answers are correct

28. RNAi is used in eukaryotic cells only to defend against viruses and transposable elements.

True False

29. Histone acetyltransferases would be directly involved in which of the following?

A. Formation of open chromatin

B. Movement of the nucleosome

C. Acetylation of lysines

D. Termination of gene expression

30. CpG islands are associated with which of the following?

A. Nucleosome location

B. DNA methylation

C. Steroid hormone activity

D. cAMP pathway

31. Genomic imprinting is a result of ___________.

A. Nucleosome location

B. Histone activation

C. DNA methylation

D. Serine to leucine changes in the genetic code

32. The exons of a gene are always expressed in a functional protein.

True False

33. Guide RNA is used in which of the following processes?

A. DNA methylation

B. Alternative splicing

C. Chromatin condensation

D. RNA editing

E. None of the answers are correct

34. The stability of mRNA is due mostly to which of the following?

A. GC content of the message

B. Poly-A binding protein

C. Methylation

D. 5 capping

E. Alternative splicing

35. Explain why yeast genes with a single intron have essentially no alternative splicing.

A. Yeast genes never have alternative splicing.

B. Removal of a single intron leads to splicing of the poly-A tail which prevents further splicing.

C. Methylation of the single intron prevents further splicing.

D. Removal of a single intron only leads to one possible outcome for spliced mRNA.

E. None of the above.

36. Transcription factors are proteins that influence the ability of the RNA polymerase to transcribe a gene.

True False

37. Activator proteins bind to silencer sequences and repressor proteins bind to enhancer sequences.

True False

38. If a portion of a transcription factors domain is the same in a variety of organisms, it is called a motif.

True False

39. A heterodimer occurs when two identical transcription factors interact on a sequence of DNA.

True False

40. A repressor protein would enhance the ability of TFIID to bind to the TATA box of the promoter.

True False

41. Steroid hormomes are an example of an effector which regulates regulatory transcription factor activity.

True False

42. Receptors for steroid hormones are usually found in the nucleus of the cell.

True False

43. DNA that contains actively transcribed genes would most likely contain chromatin in the closed configuration.

True False

44. Nucleosome location may be changed by a process called ATP-dependent chromatin remodeling.

True False

45. DNA methylation activates gene expression.

True False

46. Housekeeping genes are unmethylated and active in most cells.

True False

Chapter 15 Gene Regulation in Eukaryotes Key

1. Which of the following would also work as an enhancer for the following bi-directional enhancer?
5 GTTC 3 3 CAAG 5

A. 5 GAAC 3 3 CTTG 5

B. 5 CTTG 3 3 GAAC 5

C. 5 CAAG 3 3 GTTC 5

D. More than one of the answers are correct

Blooms Level: 5. Evaluate
Learning Outcome: 15.01: Know the types of regulatory transcription factors, their structures and DNA binding sequences, and the common ways in which they are regulated.
Section: 15.01
Topic: Gene Regulation

2. What structural motifs promote dimerization?

A. Zinc finger

B. Leucine zipper

C. Helix-turn-helix

D. Helix-loop-helix

Blooms Level: 3. Apply
Learning Outcome: 15.01: Know the types of regulatory transcription factors, their structures and DNA binding sequences, and the common ways in which they are regulated.
Section: 15.01
Topic: Gene Regulation

3. Which of the following is a steroid receptor?

A. GRE

B. IRE

C. CRE

D. None of the answers are correct

Blooms Level: 2. Understand
Learning Outcome: 15.02: Understand the mechanism of action of steriod hormones.
Section: 15.01
Topic: Gene Regulation

4. Which is not an example of RNA processing regulation?

A. RNA concentration

B. RNA editing

C. Alternative splicing

D. eIF2a protein kinases

Blooms Level: 4. Analyze
Learning Outcome: 15.06: Understand how changes in RNA processing, stability, and translation can influence gene expression.
Section: 15.05
Topic: Gene Regulation

5. Based on the following mature mRNAs, what exons are constitutive?
I. 1-2-3-4-7-8-10 II. 2-4-5-6-7-9 III. 1-4-6-7-8 IV. 1-2-4-7-10

A. 1 and 2

B. 1 and 4

C. 2 and 7

D. 4 and 7

Blooms Level: 5. Evaluate
Learning Outcome: 15.06: Understand how changes in RNA processing, stability, and translation can influence gene expression.
Section: 15.05
Topic: Gene Regulation

6. What is an example of RNA editing?

A. Changing a valine codon to a stop codon

B. Methylation of cytosine bases

C. Formation of RISC

D. Alternative splicing

Blooms Level: 4. Analyze
Learning Outcome: 15.06: Understand how changes in RNA processing, stability, and translation can influence gene expression.
Section: 15.05
Topic: Gene Regulation

7. Which of the following mRNAs would be found at the lowest concentration?

A. 5 GGAUGGCCGUUUGAAAAAAAAAAAAAAAAAAAAA 3

B. 5 GGAUGGCGACCUGAAUUUAAUUUAAUUUAAAAAA 3

C. 5 GGAUGGAAGUUUGAAUUUAAUUUAAAAAAAAAAA 3

D. 5 GGAUGGGGACUUGAAUUAAAAAAAAAAAAAAAAA 3

Blooms Level: 5. Evaluate
Learning Outcome: 15.06: Understand how changes in RNA processing, stability, and translation can influence gene expression.
Section: 15.05
Topic: Gene Regulation

8. Where is the IRE located in the ferritin gene?

A. 5 end of DNA

B. 5 end of mRNA

C. 3 end of DNA

D. 3 end of mRNA

Blooms Level: 2. Understand
Learning Outcome: 15.06: Understand how changes in RNA processing, stability, and translation can influence gene expression.
Section: 15.05
Topic: Gene Regulation

9. A mutation in which of the following would result in little or no expression of a gene regulated by a CRE?

A. G protein

B. Adenylyl cyclase

C. Protein kinase A

D. All of the answers are correct

Blooms Level: 4. Analyze
Learning Outcome: 15.01: Know the types of regulatory transcription factors, their structures and DNA binding sequences, and the common ways in which they are regulated.
Section: 15.01
Topic: Gene Regulation

10. What activates CREB?

A. Binding of cAMP

B. Phosphorylation

C. Dimerization

D. None of the answers are correct

Blooms Level: 2. Understand
Learning Outcome: 15.01: Know the types of regulatory transcription factors, their structures and DNA binding sequences, and the common ways in which they are regulated.
Section: 15.01
Topic: Gene Regulation

11. What would be the result of a mutation in Hsp90?

A. Glucocorticoid receptor could not form a dimmer

B. The nuclear localization signal would no longer function

C. Expression of the regulated genes would become constitutive

D. The hormone would not be able to bind to the glucocorticoid receptor

Blooms Level: 4. Analyze
Learning Outcome: 15.01: Know the types of regulatory transcription factors, their structures and DNA binding sequences, and the common ways in which they are regulated.
Section: 15.01
Topic: Gene Regulation

12. Which mechanisms are used by miRNAs to regulate gene expression?

A. Targeted degradation of mRNAs

B. Targeted inhibition of mRNA translation

C. Both A and B

D. Neither A nor B

Blooms Level: 4. Analyze
Learning Outcome: 15.06: Understand how changes in RNA processing, stability, and translation can influence gene expression.
Section: 15.05
Topic: Gene Regulation

13. A person with a mutation in IRP that prevents it from binding iron. What effect will this have?

A. Ferritin will not be made, so iron intake must be maximized

B. There will be excess ferritin, so iron intake must be lowered

C. Transferrin will not be made, so iron intake must be maximized

D. There will be excess transferrin, so iron intake must be lowered

Blooms Level: 5. Evaluate
Learning Outcome: 15.06: Understand how changes in RNA processing, stability, and translation can influence gene expression.
Section: 15.05
Topic: Gene Regulation

14. What mechanism of RNA regulation is responsible for the two different forms of apolipoprotein B?

A. Alternative splicing

B. RNA editing

C. RNA interference

D. Covalent modification of RNA

Blooms Level: 3. Apply
Learning Outcome: 15.06: Understand how changes in RNA processing, stability, and translation can influence gene expression.
Section: 15.05
Topic: Gene Regulation

15. What basal transcription factor is most often affected by regulatory transcription factors?

A. TFIIB

B. TFIID

C. TFIIE

D. TFIIF

Blooms Level: 4. Analyze
Learning Outcome: 15.01: Know the types of regulatory transcription factors, their structures and DNA binding sequences, and the common ways in which they are regulated.
Section: 15.01
Topic: Gene Regulation

16. SR proteins are splicing factors rich in _____.

A. Arginine

B. Cysteine

C. Asparagine

D. Proline

Blooms Level: 2. Understand
Learning Outcome: 15.06: Understand how changes in RNA processing, stability, and translation can influence gene expression.
Section: 15.05
Topic: Gene Regulation

17. Which of the following relationships is true?

A. The more stable an mRNA is, the higher its concentration

B. The more unstable an mRNA is, the lower its concentration

C. The more unstable an mRNA is, the higher its concentration

D. More than one of the answers are correct

Blooms Level: 5. Evaluate
Learning Outcome: 15.06: Understand how changes in RNA processing, stability, and translation can influence gene expression.
Section: 15.05
Topic: Gene Regulation

18. eIF2a is phosphorylated in order to inhibit transcription. What is occurring at the molecular level?

A. Phosphorylated eIF2a binds to tRNAs, preventing them from attaching its amino acid

B. Phosphorylated eIF2a binds to eIF2B, inhibiting its activity

C. Phosphorylated eIF2a binds to the mRNA, blocking the Shine-Delgarno sequence and preventing translational initiation

D. All of the answers are correct

Blooms Level: 5. Evaluate
Learning Outcome: 15.06: Understand how changes in RNA processing, stability, and translation can influence gene expression.
Section: 15.05
Topic: Gene Regulation

19. S1 nuclease will cleave which of the following?

A. Double-stranded DNA

B. Single-stranded DNA

C. A single-stranded probe hybridized to a particular gene

D. Chromosomal DNA in an open conformation

Blooms Level: 2. Understand
Learning Outcome: 15.03: Know the relationship between chromatin structure and gene expression.
Section: 15.02
Topic: Gene Regulation

20. In which of the following scenarios would gene expression be the lowest?

A. The CpG island upstream of the gene is unmethylated

B. Injecting antisense RNA corresponding to the mRNA of the gene

C. Deletion of a sequence upstream of the gene known to be a silencer

D. Injecting double-stranded RNA corresponding to the mRNA of the gene

Blooms Level: 4. Analyze
Learning Outcome: 15.06: Understand how changes in RNA processing, stability, and translation can influence gene expression.
Section: 15.05
Topic: Gene Regulation

21. Transcription factors recognize which of the following?

A. Response elements

B. Control elements

C. Regulatory elements

D. All of the answers are correct

Blooms Level: 4. Analyze
Learning Outcome: 15.01: Know the types of regulatory transcription factors, their structures and DNA binding sequences, and the common ways in which they are regulated.
Section: 15.01
Topic: Gene Regulation

22. Which of the following is an example of a motif found in transcription factors?

A. Zinc finger

B. Leucine zipper

C. Helix-turn-helix

D. Helix-loop-helix

E. All of the answers are correct

Blooms Level: 2. Understand
Learning Outcome: 15.01: Know the types of regulatory transcription factors, their structures and DNA binding sequences, and the common ways in which they are regulated.
Section: 15.01
Topic: Gene Regulation

23. Regulatory transcription factors may influence gene expression in which of the following ways?

A. Recruiting proteins to the promoter that enhance chromatin compaction

B. By effecting the ability of TFIID to bind to the core promoter

C. Influencing the ability of the RNA polymerase to form an initiation complex

D. All of the answers are correct

Blooms Level: 5. Evaluate
Learning Outcome: 15.01: Know the types of regulatory transcription factors, their structures and DNA binding sequences, and the common ways in which they are regulated.
Section: 15.01
Topic: Gene Regulation

24. Regulatory transcription factors may be regulated by __________.

A. Covalent modifications

B. Protein-protein interactions

C. Use of effector molecules

D. All of the answers are correct

Blooms Level: 4. Analyze
Learning Outcome: 15.01: Know the types of regulatory transcription factors, their structures and DNA binding sequences, and the common ways in which they are regulated.
Section: 15.01
Topic: Gene Regulation

25. Which of the following is incorrect regarding the glucocorticoid hormomes?

A. They interact with receptors located in the plasma membrane of the cell

B. After interacting with the receptor, they release HSP90

C. The receptors form a homodimer that travels to the nucleus

D. The homodimer interacts with GRE, activating transcription

Blooms Level: 4. Analyze
Learning Outcome: 15.02: Understand the mechanism of action of steriod hormones.
Section: 15.01
Topic: Gene Regulation

26. cAMP is known as a second messenger system since the pathway is first activated by a extracellular signaling molecule

TRUE

Blooms Level: 3. Apply
Learning Outcome: 15.02: Understand the mechanism of action of steriod hormones.
Section: 15.01
Topic: Gene Regulation

27. Which one of the following directly interacts with the DNA as a transcriptional regulator?

A. cAMP

B. G protein

C. Protein kinase A

D. CREB protein dimmer

E. None of the answers are correct

Blooms Level: 2. Understand
Learning Outcome: 15.01: Know the types of regulatory transcription factors, their structures and DNA binding sequences, and the common ways in which they are regulated.
Section: 15.01
Topic: Gene Regulation

28. RNAi is used in eukaryotic cells only to defend against viruses and transposable elements.

FALSE

Blooms Level: 3. Apply
Learning Outcome: 15.06: Understand how changes in RNA processing, stability, and translation can influence gene expression.
Section: 15.05
Topic: Gene Regulation

29. Histone acetyltransferases would be directly involved in which of the following?

A. Formation of open chromatin

B. Movement of the nucleosome

C. Acetylation of lysines

D. Termination of gene expression

Blooms Level: 3. Apply
Learning Outcome: 15.03: Know the relationship between chromatin structure and gene expression.
Section: 15.02
Topic: Gene Regulation

30. CpG islands are associated with which of the following?

A. Nucleosome location

B. DNA methylation

C. Steroid hormone activity

D. cAMP pathway

Blooms Level: 2. Understand
Learning Outcome: 15.04: Know the effect of DNA methylation on gene expression.
Section: 15.03
Topic: Gene Regulation

31. Genomic imprinting is a result of ___________.

A. Nucleosome location

B. Histone activation

C. DNA methylation

D. Serine to leucine changes in the genetic code

Blooms Level: 3. Apply
Learning Outcome: 15.04: Know the effect of DNA methylation on gene expression.
Section: 15.03
Topic: Gene Regulation

32. The exons of a gene are always expressed in a functional protein.

FALSE

Blooms Level: 3. Apply
Learning Outcome: 15.06: Understand how changes in RNA processing, stability, and translation can influence gene expression.
Section: 15.05
Topic: Gene Regulation

33. Guide RNA is used in which of the following processes?

A. DNA methylation

B. Alternative splicing

C. Chromatin condensation

D. RNA editing

E. None of the answers are correct

Blooms Level: 3. Apply
Learning Outcome: 15.06: Understand how changes in RNA processing, stability, and translation can influence gene expression.
Section: 15.05
Topic: Gene Regulation

34. The stability of mRNA is due mostly to which of the following?

A. GC content of the message

B. Poly-A binding protein

C. Methylation

D. 5 capping

E. Alternative splicing

Blooms Level: 3. Apply
Learning Outcome: 15.06: Understand how changes in RNA processing, stability, and translation can influence gene expression.
Section: 15.05
Topic: Gene Regulation

35. Explain why yeast genes with a single intron have essentially no alternative splicing.

A. Yeast genes never have alternative splicing.

B. Removal of a single intron leads to splicing of the poly-A tail which prevents further splicing.

C. Methylation of the single intron prevents further splicing.

D. Removal of a single intron only leads to one possible outcome for spliced mRNA.

E. None of the above.

Blooms Level: 5. Evaluate
Learning Outcome: 15.06: Understand how changes in RNA processing, stability, and translation can influence gene expression.
Section: 15.05
Topic: Gene Regulation

36. Transcription factors are proteins that influence the ability of the RNA polymerase to transcribe a gene.

TRUE

Blooms Level: 2. Understand
Learning Outcome: 15.01: Know the types of regulatory transcription factors, their structures and DNA binding sequences, and the common ways in which they are regulated.
Section: 15.01
Topic: Gene Regulation

37. Activator proteins bind to silencer sequences and repressor proteins bind to enhancer sequences.

FALSE

Blooms Level: 4. Analyze
Learning Outcome: 15.01: Know the types of regulatory transcription factors, their structures and DNA binding sequences, and the common ways in which they are regulated.
Section: 15.01
Topic: Gene Regulation

38. If a portion of a transcription factors domain is the same in a variety of organisms, it is called a motif.

TRUE

Blooms Level: 3. Apply
Learning Outcome: 15.01: Know the types of regulatory transcription factors, their structures and DNA binding sequences, and the common ways in which they are regulated.
Section: 15.01
Topic: Gene Regulation

39. A heterodimer occurs when two identical transcription factors interact on a sequence of DNA.

FALSE

Blooms Level: 3. Apply
Learning Outcome: 15.01: Know the types of regulatory transcription factors, their structures and DNA binding sequences, and the common ways in which they are regulated.
Section: 15.01
Topic: Gene Regulation

40. A repressor protein would enhance the ability of TFIID to bind to the TATA box of the promoter.

FALSE

Blooms Level: 3. Apply
Learning Outcome: 15.01: Know the types of regulatory transcription factors, their structures and DNA binding sequences, and the common ways in which they are regulated.
Section: 15.01
Topic: Gene Regulation

41. Steroid hormomes are an example of an effector which regulates regulatory transcription factor activity.

TRUE

Blooms Level: 4. Analyze
Learning Outcome: 15.02: Understand the mechanism of action of steriod hormones.
Section: 15.01
Topic: Gene Regulation

42. Receptors for steroid hormones are usually found in the nucleus of the cell.

FALSE

Blooms Level: 2. Understand
Learning Outcome: 15.02: Understand the mechanism of action of steriod hormones.
Section: 15.01
Topic: Gene Regulation

43. DNA that contains actively transcribed genes would most likely contain chromatin in the closed configuration.

FALSE

Blooms Level: 3. Apply
Learning Outcome: 15.03: Know the relationship between chromatin structure and gene expression.
Section: 15.02
Topic: Gene Regulation

44. Nucleosome location may be changed by a process called ATP-dependent chromatin remodeling.

TRUE

Blooms Level: 3. Apply
Learning Outcome: 15.03: Know the relationship between chromatin structure and gene expression.
Section: 15.02
Topic: Gene Regulation

45. DNA methylation activates gene expression.

FALSE

Blooms Level: 3. Apply
Learning Outcome: 15.04: Know the effect of DNA methylation on gene expression.
Section: 15.03
Topic: Gene Regulation

46. Housekeeping genes are unmethylated and active in most cells.

TRUE

Blooms Level: 3. Apply
Learning Outcome: 15.04: Know the effect of DNA methylation on gene expression.
Section: 15.03
Topic: Gene Regulation

Chapter 15 Gene Regulation in Eukaryotes Summary

Category # of Questions
Blooms Level: 2. Understand 10
Blooms Level: 3. Apply 16
Blooms Level: 4. Analyze 12
Blooms Level: 5. Evaluate 8
Learning Outcome: 15.01: Know the types of regulatory transcription factors, their structures and DNA binding sequences, and the common ways in which they are regulated. 16
Learning Outcome: 15.02: Understand the mechanism of action of steriod hormones. 5
Learning Outcome: 15.03: Know the relationship between chromatin structure and gene expression. 4
Learning Outcome: 15.04: Know the effect of DNA methylation on gene expression. 4
Learning Outcome: 15.06: Understand how changes in RNA processing, stability, and translation can influence gene expression. 17
Section: 15.01 21
Section: 15.02 4
Section: 15.03 4
Section: 15.05 17
Topic: Gene Regulation 46

Write a review

Your Name:


Your Review: Note: HTML is not translated!

Rating: Bad           Good

Enter the code in the box below: